Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU219141

Sigma-Aldrich

MISSION® esiRNA

targeting human UGT1A3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCATTGGGGGCATCAACTGTGCCAACAGGAAGCCACTATCTCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinkyoung Kim et al.
BMC cancer, 13, 383-383 (2013-08-14)
Heregulin (HRG; also known as neuregulin) is a ligand for ErbB3. One of its isotypes, HRG-β1, binds to ErbB3 and forms heterodimers with other ErbB family members, thereby enhancing the proliferation and tumorigenesis of breast cancer cells. HRG stimulation may
Xueyan Zhou et al.
Nature communications, 5, 4573-4573 (2014-09-04)
Bile acids play a pivotal role in the pathological development of inflammatory bowel disease (IBD). However, the mechanism of bile acid dysregulation in IBD remains unanswered. Here we show that intestinal peroxisome proliferator-activated receptor α (PPARα)-UDP-glucuronosyltransferases (UGTs) signalling is an
Nicolás Sarute et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(32), 19497-19506 (2020-07-29)
Understanding the genetics of susceptibility to infectious agents is of great importance to our ability to combat disease. Here, we show that voltage-gated calcium channels (VGCCs) are critical for cellular binding and entry of the New World arenaviruses Junín and
Tingting Lin et al.
Journal of experimental & clinical cancer research : CR, 38(1), 150-150 (2019-04-10)
Deregulated ErbB signaling plays an important role in tumorigenesis of pancreatic cancer. However, patients with pancreatic cancer benefit little from current existed therapies targeting the ErbB signaling. Here, we explore the potential anti-tumor activity of Valproic acid against pancreatic cancer
Jin Chen et al.
Biochemical and biophysical research communications, 501(1), 212-219 (2018-05-02)
We had previously demonstrated that increased expression of ErbB3 is required for ErbB2-mediated paclitaxel resistance in breast cancer cells. In the present study, we have explored the possible role of mesenchymal stem cells (MSCs) in regulating the paclitaxel-sensitivity of ErbB2/ErbB3-coexpressing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique