Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU157081

Sigma-Aldrich

MISSION® esiRNA

targeting human NFATC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCACCACCAGCTATGAGAAGATAGTGGGCAACACCAAAGTCCTGGAGATACCCTTGGAGCCCAAAAACAACATGAGGGCAACCATCGACTGTGCGGGGATCTTGAAGCTTAGAAACGCCGACATTGAGCTGCGGAAAGGCGAGACGGACATTGGAAGAAAGAACACGCGGGTGAGACTGGTTTTCCGAGTTCACATCCCAGAGTCCAGTGGCAGAATCGTCTCTTTACAGACTGCATCTAACCCCATCGAGTGCTCCCAGCGATCTGCTCACGAGCTGCCCATGGTTGAAAGACAAGACACAGACAGCTGCCTGGTCTATGGCGGCCAGCAAATGATCCTCACGGGGCAGAACTTTACATCCGAGTCCAAAGTTGTGTTTACTGAGAAGACCACAGATGGACAGCAAATTTGGG

Numéro d'accès Ensembl | humain

ENSG00000101096

Numéro d'accès NCBI

NM_001136021

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NFATC2(4773) , NFATC2(4773)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Joyce V Lee et al.
Genes & development, 32(7-8), 497-511 (2018-04-21)
The metabolite acetyl-coenzyme A (acetyl-CoA) is the required acetyl donor for lysine acetylation and thereby links metabolism, signaling, and epigenetics. Nutrient availability alters acetyl-CoA levels in cancer cells, correlating with changes in global histone acetylation and gene expression. However, the
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using
Yanjiao Huang et al.
Experimental and therapeutic medicine, 20(2), 736-747 (2020-08-04)
Store-operated Ca2+ entry (SOCE) is the stable calcium channel influx in most cells. It consists of the cytoplasmic ion channel ORAI and endoplasmic reticulum receptor stromal interaction molecule 1 (STIM1). Abolition of SOCE function due to ORAI1 and STIM1 gene
Christina Springstead Scanlon et al.
Nature communications, 6, 6885-6885 (2015-04-29)
Perineural invasion (PNI) is an indicator of poor survival in multiple cancers. Unfortunately, there is no targeted treatment for PNI since the molecular mechanisms are largely unknown. PNI is an active process, suggesting that cancer cells communicate with nerves. However

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique