Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU153781

Sigma-Aldrich

MISSION® esiRNA

targeting human SDC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le13 mai 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le13 mai 2025

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACGGCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACGGGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGCCTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAGAAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAGAAGCCCACCAAACAGGAGGAATTCTATGCCTGACGCGGGAGCCATGCGCCCCCTCCGCCCTGCCACTCACTAGGCCCCCACTTGCCTCTTCCTTGAAGAACTGCAGGCCCTGGCCTCCCCTGCCACCAGGCCACCTCCCCAGCATTCCAGCCCCTCTGGTCGCTCCTGCCCACGGAGTCGTGGGGTGTGCTGGGAGCTCCACTCTGCTTCTCTGACTTCTGCCTGGAGACTTAGGGCACCAGGGGTTTCTCGCATAGGACCTTTCCACCACAGC

Numéro d'accès Ensembl | humain

ENSG00000115884

Numéro d'accès NCBI

NM_002997

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SDC1(6382) , SDC1(6382)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
SFT
DHT
DOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shiyu Hu et al.
Frontiers in microbiology, 11, 105-105 (2020-03-11)
Porcine hemagglutinating encephalomyelitis virus (PHEV) is a single-stranded RNA coronavirus that causes nervous dysfunction in the infected hosts and leads to widespread alterations in the host transcriptome by modulating specific microRNA (miRNA) levels. MiRNAs contribute to RNA virus pathogenesis by
Zhou Jing et al.
Cell biology international, 44(3), 894-904 (2019-12-24)
Disabled-2 (Dab2) and PAR-3 (partitioning defective 3) are reported to play critical roles in maintaining retinal microvascular endothelial cells biology by regulating VEGF-VEGFR-2 signaling. The role of Dab2 and PAR-3 in glomerular endothelial cell (GEnC) is unclear. In this study
Saritha Adepu et al.
American journal of physiology. Renal physiology, 309(2), F137-F145 (2015-05-15)
Syndecan-1 is a transmembrane heparan sulfate proteoglycan involved in regenerative growth and cellular adhesion. We hypothesized that the induction of tubular syndecan-1 is a repair response to incipient renal damage in apparently stable, uncomplicated renal transplant recipients. We quantified tubular
Ildiko Kasza et al.
PLoS genetics, 10(8), e1004514-e1004514 (2014-08-08)
Homeostatic temperature regulation is fundamental to mammalian physiology and is controlled by acute and chronic responses of local, endocrine and nervous regulators. Here, we report that loss of the heparan sulfate proteoglycan, syndecan-1, causes a profoundly depleted intradermal fat layer

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique