Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU150721

Sigma-Aldrich

MISSION® esiRNA

targeting human RUVBL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTGCATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATGGGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAATAAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTTGTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAGTCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGCACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATG

Numéro d'accès Ensembl | humain

ENSG00000175792

Numéro d'accès NCBI

NM_003707

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RUVBL1(8607) , RUVBL1(8607)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fabian Zimmermann et al.
Science advances, 6(51) (2020-12-24)
The microtubule nucleator γ-tubulin ring complex (γTuRC) is essential for the function of microtubule organizing centers such as the centrosome. Since its discovery over two decades ago, γTuRC has evaded in vitro reconstitution and thus detailed structure-function studies. Here, we
O Breig et al.
Leukemia, 28(6), 1271-1279 (2013-12-18)
The oncogenic fusion protein AML1-ETO, also known as RUNX1-RUNX1T1 is generated by the t(8;21)(q22;q22) translocation, one of the most frequent chromosomal rearrangements in acute myeloid leukemia (AML). Identifying the genes that cooperate with or are required for the oncogenic activity
M Jane Morwitzer et al.
Viruses, 11(4) (2019-04-26)
Ebola virus (EBOV) is a filovirus that has become a global public health threat in recent years. EBOV is the causative agent of a severe, often fatal hemorrhagic fever. A productive viral infection relies on the successful recruitment of host

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique