Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU149011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC5A2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGCTGCATATTTCCTGCTGGTCATTGGCGTTGGCTTGTGGTCCATGTGCAGAACCAACAGAGGCACTGTGGGCGGCTACTTCCTGGCAGGACGCAGCATGGTGTGGTGGCCGGTTGGGGCCTCTCTCTTCGCCAGCAACATCGGCAGTGGCCACTTTGTGGGCCTGGCAGGGACTGGCGCTGCAAGTGGCTTGGCTGTTGCTGGATTCGAGTGGAATGCGCTCTTCGTGGTGCTGCTACTGGGCTGGCTGTTTGCACCCGTGTACCTGACAGCGGGGGTCATCACGATGCCACAGTACCTGCGCAAGCGCTTCGGCGGCCGCCGCATCCGCCTCTACCTGTCTGTGCTCTCCCTTTTCCTGTACATCTTCACCAAGATCTCAGTGGACATGTTCTCCGGAGCTGTATTCATCCAGCAGGCTCTGGGCTGGAACATCTA

Numéro d'accès Ensembl | humain

ENSG00000140675

Numéro d'accès NCBI

NM_003041

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC5A2(6524) , SLC5A2(6524)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

H Ida-Yonemochi et al.
Journal of dental research, 99(8), 977-986 (2020-04-30)
Glucose is an essential source of energy for mammalian cells and is transported into the cells by glucose transporters. There are 2 types of glucose transporters: one is a passive glucose transporter, GLUT (SLC2A), and the other is a sodium-dependent
Jinpeng Li et al.
JCI insight, 5(6) (2020-03-07)
Sodium glucose cotransporter 2 (SGLT2) inhibitors are beneficial in halting diabetic kidney disease; however, the complete mechanisms have not yet been elucidated. The epithelial-mesenchymal transition (EMT) is associated with the suppression of sirtuin 3 (Sirt3) and aberrant glycolysis. Here, we
Jin Hee Kim et al.
Diabetes, obesity & metabolism, 22(3), 373-382 (2019-11-07)
To investigate the effect of dapagliflozin, a sodium-glucose co-transporter-2 (SGLT2) inhibitor, on renal gluconeogenesis in vitro, ex vivo and in vivo. We treated HK-2 cells (human renal proximal tubule cells) and mouse primary renal proximal tubule cells with dapagliflozin, and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique