Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU147971

Sigma-Aldrich

MISSION® esiRNA

targeting human MIF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGGTGTCCGAGAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGGGCTGGAACAACTC

Numéro d'accès Ensembl | humain

ENSG00000099964

Numéro d'accès NCBI

NM_002415

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MIF(4282) , MIF(4282)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Milica Jovanović Krivokuća et al.
Reproduction, fertility, and development (2020-12-17)
Extravillous trophoblasts are specific placental cells that invade the uterine stroma and spiral arteries modifying and adjusting them to pregnancy. Many pregnancy pathologies are associated with impairment of this process, including preeclampsia and intrauterine growth restriction, among others. Macrophage migration
Yu Zhang et al.
Clinical and experimental pharmacology & physiology, 43(11), 1134-1144 (2016-10-21)
Macrophage migration inhibitory factor (MIF), a pleiotropic pro-inflammatory cytokine, is a key regulator in both innate and acquired immunity systems. MIF has become a promising drug target for inflammatory diseases. Apart from its cytokine activities, MIF is known to act
Mei Zhang et al.
Molecular carcinogenesis, 58(6), 898-912 (2019-01-23)
Macrophage migration inhibitory factor (MIF) is a prominent orchestrator during the onset and progression of cancer. Recently, MIF was detected in salivary adenoid cystic carcinoma (SACC). However, its functional effect in perineural invasion (PNI) of SACC remained unknown. To illuminate
M Barbosa de Souza Rizzo et al.
QJM : monthly journal of the Association of Physicians, 111(11), 769-778 (2018-07-18)
Tumor-associated macrophages (TAMs) are important determinants of intratumoral immune evasion, neoangiogenesis, extracellular matrix remodeling and dysregulated tumor cell proliferation. Our prior studies revealed that macrophage-derived, but not tumor cell-derived, macrophage migration inhibitory factor (MIF), is an important determinant of TAM
B A Castro et al.
Oncogene, 36(26), 3749-3759 (2017-02-22)
Anti-angiogenic therapies for cancer such as VEGF neutralizing antibody bevacizumab have limited durability. While mechanisms of resistance remain undefined, it is likely that acquired resistance to anti-angiogenic therapy will involve alterations of the tumor microenvironment. We confirmed increased tumor-associated macrophages
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique