Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU144761

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTGCGGGTACGAATGCTATACTACCTGAGGCAGGAGGTTATTGGAGACCAAGCAGAAAAGGTGTTAGGGGGTGCGATTGCCAGTGAGATTGACATATGGTTCCCAGTAGTGGATCAACTGGAGGTTCCAACAACTTGGTGGGACAGTGAGGCTGACAAGTCGCTGCTCATTGGAGTCTTTAAACATGGCTATGAGAAATATAATACCATGAGGGCAGACCCAGCCTTATGTTTCCTAGAAAAGGCTGGCCGACCAGATGACAAAGCAATTGCAGCAGAACATCGAGTGTTGGATAACTTCTCTGACATAGTAGAAGGGGTTGACTTTGATAAAGATTGTGAAGATCCTGAATATAAACCACTCCAAGGTCCCCCAAAGGACCAAGATGATGAGGGTGATCCCTTGATGATGATGGATGAGGAGATCTCAGTGATTGATGGAGATGAAGCCCAGGTGACCCAACAGCCAGGCCATTTATT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Justin Cotney et al.
Nature communications, 6, 6404-6404 (2015-03-11)
Recent studies implicate chromatin modifiers in autism spectrum disorder (ASD) through the identification of recurrent de novo loss of function mutations in affected individuals. ASD risk genes are co-expressed in human midfetal cortex, suggesting that ASD risk genes converge in
Chuntao Zhao et al.
Developmental cell, 45(6), 753-768 (2018-06-20)
Disruptive mutations in chromatin remodeler CHD8 cause autism spectrum disorders, exhibiting widespread white matter abnormalities; however, the underlying mechanisms remain elusive. We show that cell-type specific Chd8 deletion in oligodendrocyte progenitors, but not in neurons, results in myelination defects, revealing
María Ceballos-Chávez et al.
PLoS genetics, 11(4), e1005174-e1005174 (2015-04-22)
While the importance of gene enhancers in transcriptional regulation is well established, the mechanisms and the protein factors that determine enhancers activity have only recently begun to be unravelled. Recent studies have shown that progesterone receptor (PR) binds regions that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique