Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU143331

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXO22

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCATTGGCTTCATGTTTGCATGCGTTGGCAGGGGCTTTCAGTATTACAGAGCCAAGGGGAATGTTGAGGCTGATGCATTTAGAAAGTTTTTTCCTAGTGTTCCCTTATTCGGCTTCTTTGGAAATGGAGAAATTGGATGTGATCGGATAGTCACTGGGAACTTTATATTGAGGAAATGTAATGAGGTAAAAGATGATGATCTGTTTCATAGCTATACAACAATAATGGCACTCATACATCTGGGGTCATCTAAATAATAATTAAAGTGGCTTTCATAATATGTAACTTTTGGGTTCTGCCTTTTTCAGAAAATGGAAACTTGGGCCATGTGTATTTCAAACAAAAATAACTTTAGATATATCTTTTTTGTAGCTTTGATTGATGCTCTAAGATCACATGAGGGTAGTATTTAATATATTAGATGAAGGACAACTTTGGACATAACACTGACTAGGAGTTGAGAGCTTTTGCATCAGGCAGAAGCAAACTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xun-Kai Hou et al.
Biochemical and biophysical research communications, 523(3), 766-772 (2020-01-18)
Long noncoding RNA small nucleolus RNA host gene 14 (SNHG14) has been shown to exert oncogenic functions in seceral cancers, but its role in osteosarcoma still unclear. In this present study, we found that SNHG14 was significantly upregulated in osteosarcoma
Feng Guo et al.
International journal of biological sciences, 15(3), 647-656 (2019-02-13)
F-box only protein 22 (FBXO22), a substrate receptor of the SKP1-Cullin 1-F-box protein (SCF) E3 ubiquitin ligase that targets key regulators of cellular activities for ubiquitylation and degradation, plays important roles in the progression of human cancer. However, little is
Long Zhang et al.
Journal of experimental & clinical cancer research : CR, 38(1), 101-101 (2019-02-28)
Deregulation of ubiquitin ligases is related to the malignant progression of human cancers. F-box only protein 22 (FBXO22), an F-box E3 ligase, is a member of the F-box protein family. However, the biological function of FBXO22 in HCC and the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique