Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU140981

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAATCTTTCAGCCTGCTTCTTCCCCAGGGTTCTGTATTGCAGCTAAGCTCAAATGTATATTTAACTTCTAGTTGCTCTTGCTTTGGTCTTCTTCCAATGATGCTTACTACAGAAAGCAAATCAGACACAATTAGAGAAGCCTTTTCCATAAAGTGTAATTTTAATGGCTGCAAAACCGGCAACCTGTAACTGCCCTTTTAAATGGCATGACAAGGTGTGCAGTGGCCCCATCCAGCATGTGTGTGTCTCTATCTTGCATCTACCTGCTCCTTGGCCTAGTCAGATGGATGTAGATACAGATCCGCATGTGTCTGTATTCATACAGCACTACTTACTTAGAGATGCTACTGTCAGTGTCCTCAGGGCTCTACCAAGACATAATGCACTGGGGTACCACATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yang Wang et al.
Journal of medical genetics, 57(9), 634-642 (2020-02-19)
Hirschsprung disease (HSCR) is a life-threatening congenital disorder in which the enteric nervous system is completely missing from the distal gut. Recent studies have shown that miR-4516 markedly inhibits cell migration, and as one of its potential targets, MAPK10 functions
Baohua Qiao et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 380-388 (2020-02-13)
Ovarian cancer (OC) represents the most lethal form of gynaecologic cancers in developed countries. To develop a better therapeutic against OC, characterizing new classes of molecular regulators such as microRNAs (miRNAs) involved in OC tumorigenesis becomes immensely important. We used
Sarah Huntwork-Rodriguez et al.
The Journal of cell biology, 202(5), 747-763 (2013-08-28)
Neurons are highly polarized cells that often project axons a considerable distance. To respond to axonal damage, neurons must transmit a retrograde signal to the nucleus to enable a transcriptional stress response. Here we describe a mechanism by which this
Dan Ploug Christensen et al.
Journal of neuroinflammation, 13(1), 59-59 (2016-03-10)
Secretion of proteopathic α-synuclein (α-SNC) species from neurons is a suspected driving force in the propagation of Parkinson's disease (PD). We have previously implicated exophagy, the exocytosis of autophagosomes, as a dominant mechanism of α-SNC secretion in differentiated PC12 or
Lihua Li et al.
Oncology reports, 37(5), 2679-2687 (2017-04-11)
miRNA-27a-3p is an important regulator of carcinogenesis and other pathological processes. However, its role in laryngeal carcinoma is still unknown. In our previous research, we found that miR-27a-3p expression was upregulated in nasopharyngeal carcinoma (NPC) using a microarray chip. In

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique