Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU137841

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPE

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGCTTGAGTTGGCTCAGAAACTTAATGAAAATTATGAGGAAGTGAAATCTATAACCAAAGAAAGAAAAGTTCTAAAGGAATTACAGAAGTCATTTGAAACAGAGAGAGACCACCTTAGAGGATATATAAGAGAAATTGAAGCTACAGGCCTACAAACCAAAGAAGAACTAAAAATTGCTCATATTCACCTAAAAGAACACCAAGAAACTATTGATGAACTAAGAAGAAGCGTATCTGAGAAGACAGCTCAAATAATAAATACTCAGGACTTAGAAAAATCCCATACCAAATTACAAGAAGAGATCCCAGTGCTTCATGAGGAACAAGAGTTACTGCCTAATGTGAAAGAAGTCAGTGAGACTCAGGAAACAATGAATGAACTGGAGTTATTAACAGAACAGTCCACAACCAAGGACTCAACAACACTGGCAA

Numéro d'accès Ensembl | humain

ENSG00000138778

Numéro d'accès NCBI

NM_001813

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CENPE(1062) , CENPE(1062)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zijie Liu et al.
Journal of experimental & clinical cancer research : CR, 28, 156-156 (2009-12-22)
CENP-E, one of spindle checkpoint proteins, plays a crucial role in the function of spindle checkpoint. Once CENP-E expression was interrupted, the chromosomes can not separate procedurally, and may result in aneuploidy which is a hallmark of most solid cancers
Lina Shan et al.
International journal of oncology, 55(1), 257-266 (2019-05-23)
Lung cancer is the most common and most lethal type of cancer. A sustained proliferative capacity is one of the hallmarks of cancer, and microtubules serve an important role in maintaining a sustained cell cycle. Therefore, understanding the regulation of
Vitali Sikirzhytski et al.
The Journal of cell biology, 217(8), 2647-2659 (2018-06-17)
For proper segregation during cell division, each chromosome must connect to the poles of the spindle via microtubule bundles termed kinetochore fibers (K-fibers). K-fibers form by two distinct mechanisms: (1) capture of astral microtubules nucleated at the centrosome by the
Carmen Taveras et al.
Cell cycle (Georgetown, Tex.), 18(12), 1349-1363 (2019-05-28)
During mitosis, Aurora B kinase is required for forming proper bi-oriented kinetochore-microtubule attachments. Current models suggest that tension exerted between a pair of sister-kinetochores (inter-kinetochore stretch) produces a spatial separation of Aurora B kinase from kinetochore-associated microtubule binding substrates, such
Zhen-Yu She et al.
Cell death discovery, 6, 25-25 (2020-05-01)
Kinesin-7 CENP-E is an essential kinetochore motor required for chromosome alignment and congression. However, the specific functions of CENP-E in the spermatogenic cells during spermatogenesis remain unknown. In this study, we find that CENP-E proteins are expressed in the spermatogonia

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique