Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU137671

Sigma-Aldrich

MISSION® esiRNA

targeting human SIX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTAAGAACCGGAGGCAAAGAGACCGGGCCGCGGAGGCCAAGGAAAGGGAGAACACCGAAAACAATAACTCCTCCTCCAACAAGCAGAACCAACTCTCTCCTCTGGAAGGGGGCAAGCCGCTCATGTCCAGCTCAGAAGAGGAATTCTCACCTCCCCAAAGTCCAGACCAGAACTCGGTCCTTCTGCTGCAGGGCAATATGGGCCACGCCAGGAGCTCAAACTATTCTCTCCCGGGCTTAACAGCCTCGCAGCCCAGTCACGGCCTGCAGACCCACCAGCATCAGCTCCAAGACTCTCTGCTCGGCCCCCTCACCTCCAGTCTGGTGGACTTGGGGTCCTAAGTGGGGAGGGACTGGGGCCTCGAAGGGATTCCTGGAGCAGCAACCACTGCAGCGACTAGGGACACTTGTAAATAGAAATCAGGAACATTTTTGCAGCTTGTTTCTGGAGTTGTTTGCGCATAAAGGAATGGTGGACTTTCACAAATATCTTTTTAAAAATCAAAACCAACAGCGATCTCAAGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hongming Wang et al.
Journal of Cancer, 11(9), 2529-2539 (2020-03-24)
SIX1 overexpression has been reported in several cancers. However, its involvement in head and neck squamous cell carcinoma (HNSCC) remains unclear. In this study we investigated the clinical significance and biological roles of SIX1 in HNSCC. SIX1 expression was upregulated
Chao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 10-17 (2018-05-29)
Osteosarcoma is the most common form of primary malignant bone cancer which is most prevalent in children and adolescents. Dysregulated expressions of SIX1 and PTEN/PI3K/AKT have been demonstrated in bone malignancies including osteosarcoma. However, the mechanism of SIX1/PTEN/PI3K/AKT on osteosarcoma

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique