Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU133721

Sigma-Aldrich

MISSION® esiRNA

targeting human CASC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Date d'expédition estimée le25 mai 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Date d'expédition estimée le25 mai 2025


Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGCAGATGGAGATTCAGAAACATAAGGACAACAAGAAACTTCCCCAAGGTATCATTATAGTCTTTAGACTTCAGACACACACCACACCTCAAATATATACACAACTGAAAGGAAAATTAAGGAAGTTTTTCAAAGAACCCTATTCCGAGTAAGAAGTGTGTTGCATGAATTTCTAAGAGCCAGAAAATGCATGACACAGGAGAAGATGTACCCTCATCTGTTCAGTGAGAGATGTGCAAATCAACATCAACACAGAACTGCTGAAGAAAAAAAATATGTCTCTGAAAAGCAACTTATTCACTGGAGATGTGAGGAGCCATCCGCACATCACAATTCTATAGACATCAAACGCATGAAGCATTTCGGATCTGCTTTAAGACTGAGGCAGACTTTCCATCTGGACACAGCCGACCATCCATGTGTCATTACAATGAATCCAGCACTTCCCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CASC2(255082)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Y X Dai et al.
Journal of biological regulators and homeostatic agents, 34(1), 49-56 (2020-03-07)
Dysregulation of lncRNA cancer susceptibility candidate 2 (CASC2) is involved in the pathogenesis of multiple malignancies. However, the underlying mechanisms by which lncRNA CASC2 regulates the proliferation of hemangiomas (HAs) remain undocumented. Herein, the expression levels of lncRNA CASC2 and
Yufeng Wang et al.
Molecular cancer, 16(1), 123-123 (2017-07-19)
Recently, it has been reported that long non-coding RNA (lncRNA) cancer susceptibility candidate 2 (CASC2), a novel tumor suppressor, participates in regulating the carcinogenesis and suppresses tumor progression by sponging microRNAs (miRNAs). However, the expression and function of CASC2 in
Chenjing Wang et al.
Molecular medicine (Cambridge, Mass.), 26(1), 74-74 (2020-07-24)
Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells
Qi-Yu Liu et al.
The Kaohsiung journal of medical sciences, 37(4), 268-275 (2020-12-19)
Long noncoding RNA (lncRNA) Cancer Susceptibility 2 (CASC2) has been proved to contribute to the development of cancers. However, the mechanism behind the action of CASC2 in thyroid cancer is not quite clear. We demonstrated that CASC2 was downregulated in

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique