Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU132581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGGATGGGAAGAGAGAACTCACACAGATGGAAGAATCTTCTACATAAATCACAATATAAAAAGAACACAATGGGAAGATCCTCGGTTGGAGAATGTAGCAATAACTGGACCAGCAGTGCCCTACTCCAGGGATTACAAAAGAAAGTATGAGTTCTTCCGAAGAAAGTTGAAGAAGCAGAATGACATTCCAAACAAATTTGAAATGAAACTTCGCCGAGCAACTGTTCTTGAAGACTCTTACCGGAGAATTATGGGTGTCAAGAGAGCAGACTTCCTGAAGGCTCGACTGTGGATTGAGTTTGATGGTGAAAAGGGATTGGATTATGGAGGAGTTGCCAGAGAATGGTTCTTCCTGATCTCAAAGGAAATGTTTAACCCTTATTATGGGTTGTTTGAATATTCTGCTACGGACAATTATACCCTACAGATAAATCCAAACTCTGGATTGTGTAACGAAGATCACCTCTCTTACTTCAAGTTTATTGGTCGGGTAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shaoyan Feng et al.
Cell cycle (Georgetown, Tex.), 16(9), 869-878 (2017-04-06)
Nasopharyngeal carcinoma (NPC) is a highly invasive head-neck cancer derived from the nasopharyngeal epithelium, mainly prevalent in southern China and Southeast Asia. Radiotherapy and adjuvant cisplatin (DDP) chemotherapy are standard administrations applied in the treatment of NPC. However, resistance to
Seon-Ae Jeon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 14772-14783 (2019-11-07)
E3 ubiquitin ligases are involved in the regulation of oxidative stress-induced cell death. In this study, we investigated the role of neural precursor cell-expressed, developmentally down-regulated protein 4 (NEDD4) in regulation of hydrogen peroxide (H2O2)-induced cell proliferation and apoptosis in
Wu Wen et al.
Cell cycle (Georgetown, Tex.), 16(16), 1509-1514 (2017-07-27)
The neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) plays a pivotal oncogenic role in various types of human cancers. However, the function of NEDD4 in bladder cancer has not been fully investigated. In the present study, we aim to
Qiong Lin et al.
Journal of cell science, 130(22), 3839-3850 (2017-10-13)
Our previous studies have shown that the HECT E3 ubiquitin ligase NEDD4 interacts with LC3 and is required for starvation and rapamycin-induced activation of autophagy. Here, we report that NEDD4 directly binds to SQSTM1 via its HECT domain and polyubiquitylates
Jin Zhang et al.
American journal of translational research, 11(6), 3461-3471 (2019-07-18)
Prostate cancer is the second most common malignancy among men and causes a myriad of health problem for males that are diagnosed with the cancer. Although the 5-year relative survival rate of prostate cancer patients has been significantly increased due

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique