Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU126811

Sigma-Aldrich

MISSION® esiRNA

targeting human MRC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGTGGAAGAAGAAGCAGTCTTTCTTATGAAGATGCTGACTGTGTTGTTATTATTGGAGGTGCATCAAATGAAGCAGGAAAATGGATGGATGATACCTGCGACAGTAAACGAGGCTACATATGCCAGACACGATCCGACCCTTCCTTGACTAATCCTCCAGCAACGATTCAAACAGATGGCTTTGTTAAATATGGCAAAAGCAGCTATTCACTCATGAGACAAAAATTTCAATGGCATGAAGCGGAGACATACTGCAAGCTTCACAATTCCCTTATAGCCAGCATTCTGGATCCCTACAGTAATGCATTTGCGTGGCTGCAGATGGAAACATCTAATGAACGTGTGTGGATCGCCCTGAACAGTAACTTGACTGATAATCAATACACTTGGACTGATAAGTGGAGGGTGAGGTACACTAACTGGGCTGCTGATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinjian Huang et al.
Bioactive materials, 6(3), 770-782 (2020-10-08)
Herein, we report the synthesis of a biomimic hydrogel adhesive that addresses the poor healing of surgical anastomosis. Dopamine-conjugated xanthan gum (Da-g-Xan) is fabricated using deep insights into the molecular similarity between mussels' adhesive and dopamine as well as the
Gregor Olmes et al.
Arthritis research & therapy, 18, 90-90 (2015-01-01)
The role of macrophages in the pathogenesis of lupus nephritis, in particular their differentiation to a certain subtype (e.g., M1- or M2-like) modulating the inflammatory reaction, is unknown. Here we investigated whether the differentiation in M1- or M2-like macrophages depends
Tae-Wook Chung et al.
Oncotarget, 8(3), 4436-4448 (2016-12-30)
Tumor-derived gangliosides in the tumor microenvironment are involved in the malignant progression of cancer. However, the molecular mechanisms underlying the effects of gangliosides shed from tumors on macrophage phenotype remain unknown. Here, we showed that ganglioside GM1 highly induced the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique