Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU124231

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chenghao Lu et al.
Pathology, research and practice, 216(11), 153142-153142 (2020-09-01)
Colorectal cancer (CRC) was one of the most malignant tumors worldwide due to its metastasis. Epithelial-to-mesenchymal transition (EMT) plays an important role in CRC migration, and transforming growth factor-β (TGF-β) works as a dominating cytokine in CRC EMT process. Here
Tong Zhou et al.
EBioMedicine, 31, 217-225 (2018-05-16)
Renal fibrosis is widely considered a common mechanism leading to end-stage renal failure. Epithelial-to-mesenchymal transition (EMT) plays important roles in the pathogenesis of renal fibrosis. Runt-related transcription factor 1(RUNX1) plays a vital role in hematopoiesis via Endothelial-to-Hematopoietic Transition (EHT), a
Siyuan Zhou et al.
Biochemical and biophysical research communications, 519(3), 620-625 (2019-09-22)
Renal tubular epithelial cells (RTECs) play pivotal roles in the innate immune response in kidneys. Dendritic cell specific intracellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN) functions as both the innate immune recognition receptor and the adhesion molecule. In our previous study
AHyun Choi et al.
Blood, 130(15), 1722-1733 (2017-08-10)
The gene encoding the RUNX1 transcription factor is mutated in a subset of T-cell acute lymphoblastic leukemia (T-ALL) patients, and RUNX1 mutations are associated with a poor prognosis. These mutations cluster in the DNA-binding Runt domain and are thought to
Guangfen Mao et al.
Circulation, 136(10), 927-939 (2017-07-06)
PCTP (phosphatidylcholine transfer protein) regulates the intermembrane transfer of phosphatidylcholine. Higher platelet PCTP expression is associated with increased platelet responses on activation of protease-activated receptor 4 thrombin receptors noted in black subjects compared with white subjects. Little is known about

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique