Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU122481

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATCGCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAGGATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATCCTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCGCTTAACGGTGGCCAGCAGTCCCTCTACCGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Laura M López-Sánchez et al.
Laboratory investigation; a journal of technical methods and pathology, 101(3), 292-303 (2020-12-03)
Cancer stem cells (CSCs) are involved in the resistance of estrogen (ER)-positive breast tumors against endocrine therapy. On the other hand, nitric oxide (NO) plays a relevant role in CSC biology, although there are no studies addressing how this important
Plinio C Casarotto et al.
PeerJ, 6, e4635-e4635 (2018-04-24)
Trichotillomania (TTM) is an impulse control disorder characterized by repetitive hair pulling/trimming. Barbering behavior (BB) observed in laboratory animals is proposed as a model of TTM. The neurobiological basis of TTM is unclear, but involves striatal hyperactivity and hypoactivation of
Huan Liu et al.
Microbiology and immunology, 62(9), 594-606 (2018-07-12)
Transcriptional regulation of inducible nitric oxide synthase (iNOS) is critically involved in the pathogenesis and progression of rheumatoid arthritis (RA); however, the specific transcription factors that control this process remain largely unidentified. In the present study, it was discovered that
Fangqin Wang et al.
Biosensors & bioelectronics, 172, 112756-112756 (2020-11-17)
Acute kidney injury (AKI) is common in hospital patients. Delayed diagnosis and treatment of AKI due to the lack of efficient early diagnosis is an important cause of its high mortality. While fluorescence imaging seems promising to non-intrusively interrogate AKI-related

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique