Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU121841

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTGGTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTCCGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGCATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAAAACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCATGACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCCG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tao Li et al.
Cancer management and research, 12, 6477-6491 (2020-08-18)
Serum response factor (SRF), a sequence-specific transcription factor, is closely related to metastasis of gastric cancer, a digestive tract cancer. Herein, we probed the effect of SRF on metastasis and progression of colon cancer (CC), another digestive tract disorder, and
Xiaohong Chen et al.
American journal of translational research, 8(10), 4354-4361 (2016-11-11)
Protein tyrosine kinase 6 (PTK6) is a nonreceptor tyrosine kinase that plays a crucial role in some tumors. However, the role of PTK6 is still unknown in hepatocellular carcinoma (HCC). In this study, we demonstrated that the PTK6 expression was
Sayem Miah et al.
BMC cancer, 19(1), 78-78 (2019-01-18)
BRK is, a non-receptor tyrosine kinase, overexpressed in approximately 85% of human invasive ductal breast tumors. It is not clear whether BRK expression correlates with breast cancer subtypes, or the expression has prognostic or diagnostic significance. Herein, we investigated the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique