Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU120451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Check Cart for Availability

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCTTTGAACCACACAGCAAGGCAGGGACCGTGTTGTTCAGCCAGGGGGACAAGGGCACTTCGTGGTACATTATCTGGAAGGGATCTGTCAACGTGGTGACCCATGGCAAGGGGCTGGTGACCACCCTGCATGAGGGAGATGATTTTGGACAGCTGGCTCTGGTGAATGATGCACCCCGGGCAGCCACCATCATCCTGCGAGAAGACAACTGTCATTTCCTGCGTGTGGACAAGCAGGACTTCAACCGTATCATCAAGGATGTGGAGGCAAAGACCATGCGGCTGGAAGAACATGGCAAAGTGGTGCTGGTGCTGGAGAGAGCCTCTCAGGGCGCCGGCCCTTCCCGACCCCCAACCCCAGGCAGGAACCGGTATACAGTGATGTCTGGCACCCCAGAGAAGATCCTAGAGCTTCTGTTGGAGGCCATGGGACCAGATTCCAGTGCTCATGACCCAACAGAGACATTCCTCAGCGACTTCCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li Liu et al.
Molecular vision, 23, 1-7 (2017-02-18)
Increased inflammatory mediator levels are reported in diabetic retinopathy. We previously reported that β-adrenergic receptor agonists reduced inflammatory mediators in the diabetic retina; however, these agents cannot be given systemically. Here, we investigated whether Epac1 is key to the protective
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1
Jolanta Wiejak et al.
Biochimica et biophysica acta. Molecular cell research, 1866(2), 264-276 (2018-11-12)
Exchange protein activated by cyclic AMP (EPAC1) suppresses multiple inflammatory actions in vascular endothelial cells (VECs), partly due to its ability to induce expression of the suppressor of cytokine signalling 3 (SOCS3) gene, the protein product of which inhibits interleukin
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Hua Liu et al.
Science advances, 6(1), eaay3566-eaay3566 (2020-01-09)
In this study, we investigated the roles of Epac1 in pathological angiogenesis and its potential as a novel therapeutic target for the treatment of vasoproliferative diseases. Genetic deletion of Epac1 ameliorated pathological angiogenesis in mouse models of oxygen-induced retinopathy (OIR)

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique