Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU116031

Sigma-Aldrich

MISSION® esiRNA

targeting human FDPS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCTGCAAGCTTTCTTCCTGGTGGCAGATGACATCATGGATTCATCCCTTACCCGCCGGGGACAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCATCAATGATGCTAACCTCCTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTATTACCTGAACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGACCTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAATCTATTGTCAAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATGTACATGGCAGGAATTGATGGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAGATGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Elena Ciaglia et al.
British journal of pharmacology, 174(14), 2287-2301 (2017-04-19)
N We designed and synthesized i6A derivatives characterized by the introduction of diverse chemical moieties in the N6 position of adenosine and tested for their efficacy in U87 cells and in primary glioma cultures, derived from patients. NMR-based structural analysis
Sholeem Griffin et al.
Biology of reproduction, 99(4), 749-760 (2018-04-25)
Preventing postpartum uterine disease depends on the ability of endometrial cells to tolerate the presence of the bacteria that invade the uterus after parturition. Postpartum uterine disease and endometrial pathology in cattle are most associated with the pathogen Trueperella pyogenes.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique