Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU113851

Sigma-Aldrich

MISSION® esiRNA

targeting human PABPC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCTCCTAAATGATCGCAAAGTATTTGTTGGACGATTTAAGTCTCGTAAAGAACGAGAAGCTGAACTTGGAGCTAGGGCAAAAGAATTCACCAATGTTTACATCAAGAATTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGATCTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACTGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCACAGAAAGCTGTGGATGAGATGAACGGAAAGGAGCTCAATGGAAAACAAATTTATGTTGGTCGAGCTCAGAAAAAGGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAACAGATGAAACAAGATAGGATCACCAGATACCAGGGTGTTAATCTTTATGTGAAAAATCTTGATGATGGTATTGATGATGAACGTCTCCGGAAAGAGT

Numéro d'accès Ensembl | humain

ENSG00000070756

Numéro d'accès NCBI

NM_002568

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PABPC1(26986) , PABPC1(5042)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiao Xue et al.
Pathogens (Basel, Switzerland), 9(6) (2020-06-10)
Seneca Valley Virus (SVV) is an oncolytic virus of the Picornaviridae family, which has emerged in recent years. The impact of SVV on host cell translation remains unknown. Here, we showed, for the first time, that SVV infection cleaved poly(A)
Xia Jiang et al.
PloS one, 9(7), e101993-e101993 (2014-07-08)
Despite the development and availability of hepatitis A virus (HAV) vaccine, HAV infection is still a major cause of acute hepatitis that occasionally leads to fatal liver disease. HAV internal ribosomal entry-site (IRES) is one of the attractive targets of
Nicola Guzzi et al.
Cell, 173(5), 1204-1216 (2018-04-10)
Pseudouridylation (Ψ) is the most abundant and widespread type of RNA epigenetic modification in living organisms; however, the biological role of Ψ remains poorly understood. Here, we show that a Ψ-driven posttranscriptional program steers translation control to impact stem cell commitment during

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique