Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU110931

Sigma-Aldrich

MISSION® esiRNA

targeting human SEPT7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGGGTGAATCTGGATTGGGAAAGTCGACATTAATCAACTCATTATTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCATAGAATTAAAAAGACTGTACAGGTGGAACAATCCAAAGTTTTAATCAAAGAAGGTGGTGTTCAGTTGCTGCTCACAATAGTTGATACCCCAGGATTTGGAGATGCAGTGGATAATAGTAATTGCTGGCAGCCTGTTATCGACTACATTGATAGTAAATTTGAGGACTACCTAAATGCAGAATCACGAGTGAACAGACGTCAGATGCCTGATAACAGGGTGCAGTGTTGTTTATACTTCATTGCTCCTTCAGGACATGGACTTAAACCATTGGATATTGAGTTTATGAAGCGTTTGCATGAAAAAGTGAATATCATCCCACTTATTGCCAAAGCAGACACACTCACACCAGAGGAATGCCAACAGTT

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sina Krokowski et al.
Journal of cell science, 132(9) (2019-04-18)
Pathogenic Shigella bacteria are a paradigm to address key issues of cell and infection biology. Polar localisation of the Shigella autotransporter protein IcsA is essential for actin tail formation, which is necessary for the bacterium to travel from cell-to-cell; yet
Sonja Kühn et al.
Cell reports, 31(6), 107638-107638 (2020-05-14)
The enteroinvasive bacterium Shigella flexneri forces its uptake into non-phagocytic host cells through the translocation of T3SS effectors that subvert the actin cytoskeleton. Here, we report de novo actin polymerization after cellular entry around the bacterium-containing vacuole (BCV) leading to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique