Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU109931

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCAGGAAGAGGAAACTGTTGAGAAAACGGAACTACTGGGGAAAGGGAGGGCTCACTGAGAACCATCCCGGTAACCCGATCACCGCTGGTCACCATGAACCACATTGTGCAAACCTTCTCTCCTGTCAACAGCGGCCAGCCTCCCAACTACGAGATGCTCAAGGAGGAGCAGGAAGTGGCTATGCTGGGGGTGCCCCACAACCCTGCTCCCCCGATGTCCACCGTGATCCACATCCGCAGCGAGACCTCCGTGCCTGACCATGTGGTCTGGTCCCTGTTCAACACCCTCTTCATGAACACCTGCTGCCTGGGCTTCATAGCATTCGCGTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTTTGGGCATCTTCATGACCATTCTGCTCATCATCATCCCA

Numéro d'accès Ensembl | humain

ENSG00000185201

Numéro d'accès NCBI

NM_006435

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IFITM2(10581) , IFITM2(10581)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wan-Lin Wu et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(27), 7112-7117 (2017-06-21)
CCR5 (R5)-tropic, but not CXCR4 (X4)-tropic, HIV-1 is associated with primary HIV-1 infection and transmission. Recent studies have shown that IFN-induced transmembrane (IFITM) proteins, including IFITM1, IFITM2, and IFITM3, restrict a broad range of viruses. Here, we demonstrate that an
Helena Winstone et al.
Journal of virology, 95(9) (2021-02-11)
The cellular entry of severe acute respiratory syndrome-associated coronaviruses types 1 and 2 (SARS-CoV-1 and -2) requires sequential protease processing of the viral spike glycoprotein. The presence of a polybasic cleavage site in SARS-CoV-2 spike at the S1/S2 boundary has

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique