Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU107481

Sigma-Aldrich

MISSION® esiRNA

targeting human GBP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCATCATCAGATCGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATCGTCTCTTTGTTCAGAAGCTACAAGACCTGAAGAAAAAGTACTATGAGGAACCGAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTATGACTGATGCAATTCTCCAGACAGACCAGACTCTCACAGAAAAAGAAAAGGAGATTGAAGTGGAACGTGTGAAAGCTGAGTCTGCACAGGCTTCAGCAAAAATGTTGCAGGAAATGCAAAGAAAGAATGAGCAGATGATGGAACAGAAGGAGAGGAGTTATCAGGAACACTTGAAACAACTGACTGAGAAGATGGAGAACGACAGGGTCCAGTTG

Numéro d'accès Ensembl | humain

ENSG00000117228

Numéro d'accès NCBI

NM_002053

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GBP1(2633) , GBP1(2635)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kun Zhang et al.
Oncotarget, 8(18), 30422-30437 (2017-04-19)
H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection.
J Song et al.
European review for medical and pharmacological sciences, 24(10), 5465-5472 (2020-06-05)
Non-small cell lung cancer (NSCLC) is one of the most ordinary cancers worldwide. Recent studies have discovered many oncogenes play vital roles in the tumorigenesis of malignant tumors. The purpose of our study was to uncover the role of GBP1
Ichiko Yamakita et al.
Biochemical and biophysical research communications, 518(2), 266-272 (2019-08-20)
Previously, we identified molecules involved in human invasive lung adenocarcinoma, and guanylate-binding protein 1 (GBP-1) was selected for further analysis. RT-PCR of normal lung and invasive lung adenocarcinoma tissue samples showed that the relative GBP-1 expression levels normalized to GAPDH
Arda Halu et al.
eLife, 7 (2018-10-12)
The role of pro-inflammatory macrophage activation in cardiovascular disease (CVD) is a complex one amenable to network approaches. While an indispensible tool for elucidating the molecular underpinnings of complex diseases including CVD, the interactome is limited in its utility as
Motoi Fukumoto et al.
Cancer science, 105(10), 1351-1359 (2014-08-08)
Standard fractionated radiotherapy for the treatment of cancer consists of daily irradiation of 2-Gy X-rays, 5 days a week for 5-8 weeks. To understand the characteristics of radioresistant cancer cells and to develop more effective radiotherapy, we established a series

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique