Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU106681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6AP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCAGTTCACTCCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGACCTGCTCTTTCTTTCTGAACTGCAAGTGCTACATGATATTTCAAGCTTGCTGTCTCGTCATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAGCGTTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTACAGTCTTTATGGTGGGAATGCAGTGGTAGAGTTAGTCACTGTCAAGTCATTTGACACCTCCCTCATTAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGCGAAGAACCCAGCAAGTCCCTATAACCTTGCATATAAGTATAATTTTGAATATTCCGTGGTTTTCAACATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGAT

Numéro d'accès Ensembl | humain

ENSG00000182220

Numéro d'accès NCBI

NM_005765

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATP6AP2(10159) , ATP6AP2(10159)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ting-Ting Chang et al.
European journal of clinical investigation, 46(6), 544-554 (2016-04-12)
Endothelial progenitor cell (EPC) functions are impaired in the presence of diabetes mellitus. Aliskiren is a direct renin inhibitor, which is expected to modify proangiogenic cells. This study aimed to investigate whether and how aliskiren could improve the function of
Kaori Narumi et al.
Scientific reports, 8(1), 16-16 (2018-01-10)
(Pro)renin receptor [(P)RR] is expressed in the kidney and is involved in renal injury. Although (P)RR is activated by indoxyl sulfate (IS) and may be related to renal injury, the details remain unclear. We used mouse mesangial cell line SV40
Asadur Rahman et al.
Molecular cancer therapeutics, 19(9), 1844-1855 (2020-07-17)
We previously reported that silencing of the PRR gene, which encodes the (pro)renin receptor [(P)RR], significantly reduced Wnt/β-catenin-dependent development of pancreatic ductal adenocarcinoma (PDAC). Here, we examined the effects of a panel of blocking mAbs directed against the (P)RR extracellular
Heike Wanka et al.
Journal of cellular and molecular medicine, 21(7), 1394-1410 (2017-02-20)
The (pro)renin receptor [(P)RR, ATP6AP2] is a multifunctional transmembrane protein that activates local renin-angiotensin systems, but also interacts with Wnt pathways and vacuolar H
Nehman Makdissy et al.
Stem cell research & therapy, 9(1), 132-132 (2018-05-13)
The subcellular distribution of prorenin receptor and adaptor protein ATP6AP2 may affect neurogenesis. In this study, we hypothesized that ATP6AP2 expression and subcellular relocalization from caveolae/lipid raft microdomains (CLR-Ms) to intracellular sites may correlate with neuronal differentiation (Neu-Dif) of adipose-derived
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique