Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU097551

Sigma-Aldrich

MISSION® esiRNA

targeting human TET3 (1)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC

Numéro d'accès Ensembl | humain

ENSG00000187605

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TET3(200424) , TET3(200424)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Liang-Qi Cao et al.
Molecular cancer, 18(1), 148-148 (2019-10-28)
As an important means of communication, exosomes play an important role in the development of hepatocellular carcinoma (HCC). Bioinformatics analysis, dual-luciferase reporter assays, methylation-specific quantitative PCR, and ChIP-PCR analysis were used to gain insight into the underlying mechanism of miR-21
Jie Li et al.
Journal of Cancer, 12(1), 207-216 (2021-01-05)
Background: Berberine, as an alkaloid, has a significant antitumor effect, but its mechanism in tumor metabolism, especially the Warburg effect has not been elucidated. Objectives: To study the molecular mechanism of berberine regulating the Warburg effect in ovarian cancer cells.
Suhas S Kharat et al.
Science signaling, 13(645) (2020-08-21)
Synthetic lethality between poly(ADP-ribose) polymerase (PARP) inhibition and BRCA deficiency is exploited to treat breast and ovarian tumors. However, resistance to PARP inhibitors (PARPis) is common. To identify potential resistance mechanisms, we performed a genome-wide RNAi screen in BRCA2-deficient mouse

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique