Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU096691

Sigma-Aldrich

MISSION® esiRNA

targeting human ADARB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATCACGAGGGCTACTGCACAATACATGGCCTAAGTTCCCTCTGTTCCTTCCTCTGAATCGAATGGATGTGGGTGACCGCCCGAAGGCCTTCACAGGATGGAAGTAGAATGATTTCAGTAGATACTCATTCTTGGAAAATGCCATAGTTTTAAATTATTGTTTCCAGCTTTATCAAAGACATGTTTGAAAAATAAAAAGCATCCAAGTGAGAGCTGGTGAGACCACGTGCTGCTGGCGTAGTGTAGGCCAGACATTGACAGTCCTGACGGGAGCTCAGGGCTGCCCAGCGCCCAGCGTGCACGGGACGGCCCCACGACAGAGGGAGTCAGCC

Numéro d'accès Ensembl | humain

ENSG00000197381

Numéro d'accès NCBI

NM_015834

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ADARB1(104) , ADARB1(104)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tingting Yue et al.
Neurochemistry international, 129, 104479-104479 (2019-05-31)
Previously we reported that gene expression of astrocytic 5-HT2B receptors was decreased in brains of depressed animals exposed to chronic mild stress (CMS) (Li et al., 2012) and of Parkinson's disease (Song et al., 2018). Depression is also one of
Zexiong Li et al.
Neurochemistry international, 134, 104689-104689 (2020-01-23)
The alcoholism and major depressive disorder are common comorbidity, with alcohol-induced depressive symptoms being eased by selective serotonin re-uptake inhibitors (SSRIs), although the mechanisms underlying pathology and therapy are poorly understood. Chronic alcohol consumption affects the activity of serotonin 2C
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique