Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU094041

Sigma-Aldrich

MISSION® esiRNA

targeting human MLXIPL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTCTCTTCTCTCCCAGGTTTCCCTTCCCCACCGTCCCTCCTGCCCCAGGAGTGTCTCCGCTGCCTGCTCCTGCAGCCTTCCCACCCACCCCACAGTCTGTCCCCAGCCCAGCCCCCACCCCCTTCCCCATAGAGCTTCTACCCTTGGGGTATTCGGAGCCTGCCTTTGGGCCTTGCTTCTCCATGCCCAGAGGCAAGCCCCCCGCCCCATCCCCTAGGGGACAGAAAGCCAGCCCCCCTACCTTAGCCCCTGCCACTGCCAGTCCCCCCACCACTGCGGGGAGCAACAACCCCTGCCTCACACAGCTGCTCACAGCAGCTAAGCCGGAGCAAGCCCTGGAGCCACCACTTGTATCCAGCACCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nan Chen et al.
Journal of cellular physiology, 236(1), 625-640 (2020-06-26)
Lipid deposition caused by the disorder of renal lipid metabolism is involved in diabetic nephropathy (DN). Carbohydrate response element-binding protein (ChREBP) is a key transcription factor in high glucose-induced cellular fat synthesis. At present, the regulation and mechanism of ChREBP
Susumu Suzuki et al.
Endocrine journal, 67(3), 335-345 (2019-12-10)
Carbohydrate response element binding protein (ChREBP), a glucose responsive transcription factor, mainly regulates expression of genes involved in glucose metabolism and lipogenesis. Recently, ChREBP is speculated to be involved in the onset and progression of diabetic nephropathy (DN). However, there
Can Cai et al.
International journal of molecular medicine, 42(3), 1215-1228 (2018-05-23)
Non‑alcoholic fatty liver disease (NAFLD) is a manifestation of metabolic syndrome in the liver and is closely associated with diabetes; however, its pathogenesis remains to be elucidated. Carbohydrate responsive element binding protein (ChREBP), the hub of glucolipid metabolism, regulates the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique