Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU093121

Sigma-Aldrich

MISSION® esiRNA

targeting human CTTN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Le tarif et la disponibilité ne sont pas disponibles actuellement.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGGGTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTGAAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGCATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTACCACAATGAGCAATGAGGTCGGGTTTTA

Numéro d'accès Ensembl | humain

ENSG00000085733

Numéro d'accès NCBI

NM_138565

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CTTN(2017) , CTTN(2017)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
KOU
NLU
JKU
OUT
SFT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rachel J Watkins et al.
The Journal of clinical endocrinology and metabolism, 101(12), 4551-4563 (2016-09-08)
Metastatic disease is responsible for the majority of endocrine cancer deaths. New therapeutic targets are urgently needed to improve patient survival rates. The proto-oncogene PTTG1-binding factor (PBF/PTTG1IP) is overexpressed in multiple endocrine cancers and circumstantially associated with tumor aggressiveness. This
Xiaojian Zhang et al.
Oncotarget, 8(1), 1541-1554 (2016-12-03)
Cortactin (CTTN) is overexpressed in various tumors, including head and neck squamous cell carcinoma and colorectal cancer (CRC), and can serve as a biomarker of cancer metastasis. We observed that CTTN promotes cancer cell proliferation in vitro and increases CRC
Dominik Horn et al.
Head & neck, 40(12), 2685-2694 (2018-11-21)
Cortactin (CTTN) is located on chromosome 11q13 and is associated with invasiveness in various cancer entities. CTTN protein expression could be a prognosticator of oral squamous cell carcinoma (OSCC) in terms of recurrence and survival. CTTN-dependent invasion was performed using
Yang Cheng et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 34(10), 853-858 (2018-04-17)
Vascular endothelial growth factor C (VEGF-C) accelerates cervical cancer metastasis, while the detailed mechanism remains largely unknown. Recent evidence indicates that microRNA play a crucial role in controlling cancer cell invasiveness. In the present study, we investigated the role of
Xuan Liang et al.
Nature communications, 8(1), 790-790 (2017-10-07)
Contractile adherens junctions support cell-cell adhesion, epithelial integrity, and morphogenesis. Much effort has been devoted to understanding how contractility is established; however, less is known about whether contractility can be actively downregulated at junctions nor what function this might serve.
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique