Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU092281

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS13A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCACTGAAGATCCAAGGGTATTTAAAGTAACATATGAAAGTGAGAAAGCAGAGTTAGCAGAGCAAGAAATTGCAGTGGCATTACAAGATGTTGGAATTTCTCTTGTCAACAATTACACGAAGCAAGAAGTAGCCTATATAGGCATTACAAGTTCTGATGTGGTTTGGGAAACAAAGCCCAAGAAGAAGGCAAGATGGAAGCCAATGAGTGTAAAGCACACTGAGAAGTTAGAGAGAGAATTTAAGGAATATACTGAATCTTCTCCTTCAGAAGATAAGGTTATTCAGTTGGACACTAATGTTCCGGTTCGCCTAACCCCTACTGGTCATAACATGAAAATTCTGCAGCCGCATGTAATAGCTCTACGAAGAAATTATCTTCCAGCATTAAAAGTGGAATATAACACATCTGCACATCAATCATC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Willi Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1141-1152 (2016-12-14)
Chorein, a protein encoded by VPS13A (vacuolar protein sorting-associated protein 13A), is defective in chorea acanthocytosis, a rare disease characterized by acanthocytosis of red blood cells and neuronal cell death with progressive hyperkinetic movement disorder, cognitive dysfunction, behavioral abnormalities and
Sandra Muñoz-Braceras et al.
Disease models & mechanisms, 12(2) (2019-02-03)
Members of the VPS13 family are associated with various human diseases. In particular, the loss of function of VPS13A leads to chorea-acanthocytosis (ChAc), a rare neurodegenerative disease without available curative treatments. Autophagy has been considered a promising therapeutic target because
Sabina Honisch et al.
Oncotarget, 6(12), 10309-10319 (2015-04-15)
Chorein encoded by VPS13A (vacuolar protein sorting-associated protein 13A) is defective in chorea-acanthocytosis. Chorein fosters neuronal cell survival, cortical actin polymerization and cell stiffness. In view of its anti-apoptotic effect in neurons, we explored whether chorein is expressed in cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique