Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU091281

Sigma-Aldrich

MISSION® esiRNA

targeting human FNDC3B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAAGTAACCAGAATGCACCTATAAATTATGGAGCATTGTAGATTTTACCACATCAATTCATAGCAGTAACTTTAAGAGGGCATTGTGCAATAGTTAGTTGTTTTCTTGTTCAGCTATTTTAAAGGCTGCTTTAACTTGTTTGTTTGTCTTTGTATATAACTACTTCTAATCTAATCACTAGAGTTATTATATTCTGTTATGTTTGACCAGAATTATATGACAAGAACTGGTGACAGTTTAGTGCCTCTGCCCATTGTCCATGATTTACACTAATTGTGAGCAGTCTTCTTATGTGTCAGCTCATTATTTTTGAAACATTTGCCTTTAGGCTGTTCTTTGAGGTATCAATGAAGTGATTGAATTTCAATACCTTAATTCAGTGCACATAATACTAATGTAACAGCAGATGAAAATTGATAAAACCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tingting Bian et al.
Experimental and therapeutic medicine, 17(5), 3317-3326 (2019-04-17)
Fibronectin (FN) type III domain containing 3B (FNDC3B), a member of the FN family, regulates the invasion and metastasis of cells in numerous tumor types. However, the mechanisms through which FNDC3B regulates carcinogenesis in lung adenocarcinoma (LADC) tissues have remained
Kimberly E Maxfield et al.
Molecular and cellular biology, 36(24), 3048-3057 (2016-10-05)
Triple-negative breast cancer (TNBC) is a highly heterogeneous disease with multiple, distinct molecular subtypes that exhibit unique transcriptional programs and clinical progression trajectories. Despite knowledge of the molecular heterogeneity of the disease, most patients are limited to generic, indiscriminate treatment

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique