Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU090761

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGTTTCAACAGAGGGAGTTTAATACAGGAAATTGACTTACATAGATGATAAAAGAGAAGCCAAACAGCAAGAAGCTGTTACCACACCCAGGGCTATGAGGATAATGGGAAGAGGTTTGGTTTCCTGTGTCCAGTAGTGGGATCATCCAGAGGAGCTGGAACCATGGTGGGGGCTGCCTAGTGGGAGTTAGGACCACCAATGGATTGTGGAAAATGGAGCCATGACAAGAACAAAGCCACTGACTGAGATGGAGTGAGCTGAGACAGATAAGAGAATACCTTGGTCTCACCTATCCTGCCCTCACATCTTCCACCAGCACCTTACTGCCCAGGCCTATCTGGAAGCCACCTCACCAAGGACCTTGGAAGAGCAAGGGACAGTGAGGCAGGAGAAGAACAAGAAATGGATGTAAGCCTGGCCCATAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ri Cui et al.
Oncotarget, 6(26), 21802-21815 (2015-08-27)
We recently reported that miR-224 was significantly up-regulated in non-small cell lung cancer (NSCLC) tissues, in particular in resected NSCLC metastasis. We further demonstrated that miR-224 functions as an oncogene in NSCLC by directly targeting TNFAIP1 and SMAD4. However, the
Woo Jin Jeong et al.
PloS one, 7(9), e45754-e45754 (2012-10-11)
In addition to its well-characterized role in the lens, αB-crystallin performs other functions. Methylglyoxal (MGO) can alter the function of the basement membrane of retinal pigment epithelial (RPE) cells. Thus, if MGO is not efficiently detoxified, it can induce adverse
Xiujin Shen et al.
Cell death & disease, 12(2), 186-186 (2021-02-17)
Chemotherapy drug-induced nephrotoxicity limits clinical applications for treating cancers. Pyroptosis, a newly discovered programmed cell death, was recently reported to be associated with kidney diseases. However, the role of pyroptosis in chemotherapeutic drug-induced nephrotoxicity has not been fully clarified. Herein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique