Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU089121

Sigma-Aldrich

MISSION® esiRNA

targeting human TNIK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGGGCAAGGCAAAGTCTATAATCTGATCAACCGGAGGCGATTTCAGCAGATGGATGTGCTAGAGGGACTGAATGTCCTTGTGACAATTTCAGGAAAGAAGAATAAGCTACGAGTTTACTATCTTTCATGGTTAAGAAACAGAATACTACATAATGACCCAGAAGTAGAAAAGAAACAAGGCTGGATCACTGTTGGGGACTTGGAAGGCTGTATACATTATAAAGTTGTTAAATATGAAAGGATCAAATTTTTGGTGATTGCCTTAAAGAATGCTGTGGAAATATATGCTTGGGCTCCTAAACCGTATCATAAATTCATGGCATTTAAGTCTTTTGCAGATCTCCAGCACAAGCCTCTGCTAGTTGATCTCACGGTAGAAGAAGGTCAAAGATTAAAGGTTATTTTTGGTTCACACACTGGTTTCCA

Numéro d'accès Ensembl | humain

ENSG00000154310

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TNIK(23043) , TNIK(23043)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kyeong-Yong Park et al.
PloS one, 15(8), e0232917-e0232917 (2020-08-19)
In human lung cancer progression, the EMT process is characterized by the transformation of cancer cells into invasive forms that migrate to other organs. Targeting to EMT-related molecules is emerging as a novel therapeutic approach for the prevention of lung
Martin Larhammar et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 37(46), 11074-11084 (2017-10-11)
The c-Jun-N-terminal kinase (JNK) signaling pathway regulates nervous system development, axon regeneration, and neuronal degeneration after acute injury or in chronic neurodegenerative disease. Dual leucine zipper kinase (DLK) is required for stress-induced JNK signaling in neurons, yet the factors that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique