Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU088121

Sigma-Aldrich

MISSION® esiRNA

targeting human PTBP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG

Numéro d'accès Ensembl | humain

ENSG00000011304

Numéro d'accès NCBI

NM_031991

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PTBP1(5725) , PTBP1(5725)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhi-Na Wang et al.
Oncotarget, 8(22), 36185-36202 (2017-04-14)
Polypyrimidine tract-binding protein 1 (PTBP1) involving in almost all steps of mRNA regulation including alternative splicing metabolism during tumorigenesis due to its RNA-binding activity. Initially, we found that high expressed PTBP1 and poor prognosis was interrelated in colorectal cancer (CRC)
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
Hoin Kang et al.
The Journal of pathology, 249(3), 395-408 (2019-07-14)
Polypyrimidine tract-binding protein 1 (PTBP1) is one of the most investigated multifunctional RNA-binding proteins (RBP), controlling almost all steps of mRNA metabolism and processing. It has been reported that PTBP1 is overexpressed in many different types of cancer and this
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Aline Marnef et al.
Nucleic acids research, 44(3), 1342-1353 (2015-12-15)
Human polypyrimidine tract-binding protein PTB is a multifunctional RNA-binding protein with four RNA recognition motifs (RRM1 to RRM4). PTB is a nucleocytoplasmic shuttle protein that functions as a key regulator of alternative pre-mRNA splicing in the nucleoplasm and promotes internal
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique