Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU086641

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC12A9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGAACACACTGGCTGCTGTGGTCACTGTCTTCTACCTGGTGGCCTATGCTGCCGTGGACCTGTCCTGCCTGAGCCTGGAGTGGGCCTCGGCCCCCAACTTCCGCCCCACCTTCAGCCTGTTCTCCTGGCACACCTGCCTGCTGGGGGTGGCCTCCTGCCTGCTCATGATGTTCCTCATCAGTCCTGGCGCGGCTGGTGGCTCCCTGCTCCTCATGGGTCTGCTGGCTGCCCTGCTCACCGCGCGAGGAGGCCCCAGTAGCTGGGGCTATGTCAGCCAGGCCTTGCTTTTCCACCAGGTGCGTAAGTATCTGCTTCGGCTGGACGTCCGGAAGGATCACGTGAAGTTCTGGCGGCCCCAGCTGCTGCTCCTGGTGGGGAACCCCCGGGGCGCCCTGCCTCTGCTGCGGTTGGCCAACCAGCTTAAGAAGGGG

Numéro d'accès Ensembl | humain

ENSG00000146828

Numéro d'accès NCBI

NM_020246

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC12A9(56996) , SLC12A9(56996)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anna E Vilgelm et al.
EBioMedicine, 24, 43-55 (2017-10-17)
Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique