Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU086561

Sigma-Aldrich

MISSION® esiRNA

targeting human MBNL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTTTCATCACTAAACAATCATGCTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATATCGTCAAGCAACACACACAAAAGTTCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATTTTCCGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTCAAAGATGCATACCTAGTTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGG

Numéro d'accès Ensembl | humain

ENSG00000152601

Numéro d'accès NCBI

NM_207297

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MBNL1(4154) , MBNL1(4154)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Łukasz J Sznajder et al.
Nature communications, 11(1), 2022-2022 (2020-04-26)
The thymus is a primary lymphoid organ that plays an essential role in T lymphocyte maturation and selection during development of one arm of the mammalian adaptive immune response. Although transcriptional mechanisms have been well documented in thymocyte development, co-/post-transcriptional
Svetlana S Itskovich et al.
Nature communications, 11(1), 2369-2369 (2020-05-14)
Despite growing awareness of the biologic features underlying MLL-rearranged leukemia, targeted therapies for this leukemia have remained elusive and clinical outcomes remain dismal. MBNL1, a protein involved in alternative splicing, is consistently overexpressed in MLL-rearranged leukemias. We found that MBNL1
Sandra Fischer et al.
RNA (New York, N.Y.), 26(5), 648-663 (2020-03-05)
Hypoxia is a hallmark of solid cancers, supporting proliferation, angiogenesis, and escape from apoptosis. There is still limited understanding of how cancer cells adapt to hypoxic conditions and survive. We analyzed transcriptome changes of human lung and breast cancer cells
Hongfei Liu et al.
Nucleic acids research, 46(12), 6069-6086 (2018-05-18)
We report the detailed transcriptomic profiles of human innate myeloid cells using RNA sequencing. Monocytes migrate from blood into infected or wounded tissue to differentiate into macrophages, and control inflammation via phagocytosis or cytokine secretion. We differentiated culture primary monocytes
Xin Sun et al.
Scientific reports, 5, 12521-12521 (2015-07-29)
Huntington's disease (HD) is caused by a CAG repeat expansion in the huntingtin (HTT) gene. Recent evidence suggests that HD is a consequence of multimodal, non-mutually exclusive mechanisms of pathogenesis that involve both HTT protein- and HTT RNA-triggered mechanisms. Here
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique