Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU085631

Sigma-Aldrich

MISSION® esiRNA

targeting human GNL3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCCATCAAATGTGGAACCTATGGAAAAGGAGTTTGGGCTTTGCAAAACTGAGAACAAAGCCAAGTCGGGCAAACAGAATTCAAAGAAGCTGTACTGCCAAGAACTTAAAAAGGTGATTGAAGCCTCCGATGTTGTCCTAGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGATGTCCTCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGCTGGTACTTATATTAAATAAATCAGATCTGGTACCAAAGGAGAATTTGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTCAGAGCCTCAACAAAACCAAAGGATAAAGGGAAGATAACCAAGCGTGTGAAGGCAAAGAAGAATGCTGCTCCATTCAGAAGTGAAGTCTGCTTTGGGAAAGAGGGCCTTTGGAAAC

Numéro d'accès Ensembl | humain

ENSG00000163938

Numéro d'accès NCBI

NM_014366

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GNL3(26354) , GNL3(26354)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique