Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084801

Sigma-Aldrich

MISSION® esiRNA

targeting human ETS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC

Numéro d'accès Ensembl | humain

ENSG00000134954

Numéro d'accès NCBI

NM_005238

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ETS1(2113) , ETS1(2113)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
EAV
LVU
NQU
QCS
QGT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
Manhui Zhu et al.
Cell and tissue research, 376(3), 341-351 (2019-03-06)
Choroidal neovascularization (CNV) is the basic feature of neovascular age-related macular degeneration (AMD), the leading cause of blindness in elders. Macrophages and microglia promote CNV via producing pro-angiogenic factors and inflammatory cytokines. Transcription factor E26 transformation specific-1 (Ets1) plays a
Yutao Yang et al.
Molecular neurobiology, 54(6), 4421-4431 (2016-06-29)
Galanin receptor 2 (GAL2R) is a G protein-coupled receptor for the neuropeptide galanin that regulates many important physiological functions and pathological processes. To investigate the molecular mechanism governing GAL2R gene transcription, the rat GAL2R promoter was isolated and analyzed. We
Chrisostomos Chrisostomidis et al.
International journal of dermatology, 54(9), 989-995 (2015-07-16)
The aim of this study was to investigate if the expression of CD105 and Ets-1 was predictive of aggressive biologic behavior of non-melanoma skin cancers (NMSC) and to evaluate indicators of local recurrence. A total of 144 patients with NMSC
Cherie A Kessler et al.
Endocrinology, 156(5), 1851-1859 (2015-02-05)
A possible role for the transcription factor v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) in human trophoblast cell differentiation was examined using a highly enriched fraction of human mononuclear cytotrophoblast cells (CTBs) that differentiate spontaneously in vitro to
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique