Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU083941

Sigma-Aldrich

MISSION® esiRNA

targeting human VEGFA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le28 mai 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le28 mai 2025

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCA

Numéro d'accès Ensembl | humain

ENSG00000112715

Numéro d'accès NCBI

NM_001025366

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VEGFA(7422) , VEGF(7422)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JYU
XJT
HQS
KXR
RTR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jae Hyeop Lee et al.
Journal of controlled release : official journal of the Controlled Release Society, 263, 29-38 (2017-04-05)
RNA, one of the major biological macromolecules, has been considered as an attractive building material for bottom-up fabrication of nanostructures in the past few decades due to advancements in RNA biology, RNA chemistry and RNA nanotechnology. Most recently, an isothermal
Huan Sun et al.
Journal of cellular physiology, 234(11), 20623-20633 (2019-04-21)
Myocardial ischemia is accompanied with hypoxia injury in myocardial cells. Long noncoding RNAs (lncRNA) CAMK2D-associated transcript 1 (C2dat1) C2dat1) has been linked with several ischemic diseases. However, the investigation regarding its role in myocardial ischemia is relatively rare. The aim
Zhaohui Liu et al.
Molecular immunology, 106, 153-158 (2019-01-07)
MicroRNAs (miRNAs) play important roles in kidney development and maintenance of kidney physiological functions. MiR-377 has been reported to regulate inflammation in cardiac and cerebral ischemia. However, it remains unclear whether it has a similar function in renal ischemia/reperfusion (I/R).
Yong-Chao Jiang et al.
Journal of biomedical materials research. Part A, 106(6), 1595-1603 (2018-02-11)
During the process of tissue regeneration facilitated by stem cells, physical properties of a scaffold affect behavior and activities of the cell. To enhance differentiation of human mesenchymal stem cells (MSCs) into endothelial-like cells (ELCs), we used electrospun fibrous substrates
Alberto Ouro et al.
Experimental cell research, 361(2), 277-283 (2017-10-31)
The bioactive sphingolipid ceramide 1-phosphate (C1P) regulates cell division in a variety of cell types including macrophages. However, the mechanisms involved in this action are not completely understood. In the present work we show that C1P stimulates the release of
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique