Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU082881

Sigma-Aldrich

MISSION® esiRNA

targeting human DGKA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGGCTCGATGCCTAAGATGGGGAGGAGGTTATGAAGGACAGAATCTGGCAAAGATCCTCAAGGATTTAGAGATGAGTAAAGTGGTACATATGGATCGATGGTCTGTGGAGGTGATACCTCAACAAACTGAAGAAAAAAGTGACCCAGTCCCCTTTCAAATCATCAATAACTACTTCTCTATTGGCGTGGATGCCTCTATTGCTCATCGATTCCACATCATGCGAGAGAAATATCCGGAGAAGTTCAACAGCAGAATGAAGAACAAGCTATGGTACTTCGAATTTGCCACATCTGAATCCATCTTCTCAACATGCAAAAAGCTGGAGGAGTCTTTGACAGTTGAGATCTGTGGGAAACCGCTGGATCTGAGCAACCTGTCCCTAGAAGGCATCGCAGTGCTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Inan Olmez et al.
Neuro-oncology, 20(2), 192-202 (2017-10-20)
The mesenchymal phenotype in glioblastoma (GBM) and other cancers drives aggressiveness and treatment resistance, leading to therapeutic failure and recurrence of disease. Currently, there is no successful treatment option available against the mesenchymal phenotype. We classified patient-derived GBM stem cell
Jie Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(14), 3843-3855 (2020-04-29)
Although platinum compounds are the first-line treatment for ovarian cancer, the majority of patients relapse and develop resistance to treatment. However, the mechanism underlying resistance is unclear. The goal of our study is to decipher the mechanism by which a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique