Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU079401

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGTTCAAGGGAAAGACGAGATCTTGCACAAGGCACTCTGCTTCTGCCCTTGGCTGGGGAAGGGTGGCATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACCCTCAGGAAGGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiao-Yan Wang et al.
Biochemical and biophysical research communications, 532(3), 329-335 (2020-09-27)
Drug resistance remains the unresolved obstacle for gastric cancer (GC) treatment. Recently more and more studies have shown that microRNAs are involved in cancer resistance and could apply to drug resistance therapy in tumors. The relationship between miR-149 and 5-fluorouracil
Saini Yi et al.
Cytotechnology, 72(4), 589-602 (2020-07-06)
Triggering receptor expressed on myeloid cells-2 (TREM2) is an innate immune receptor that promotes phagocytosis by microglia. However, whether TREM2 is related to the stimulus-dependent phagocytic activity of microglia is unclear. In this study, the primary cultured microglia were stimulated
Shengpan Chen et al.
Journal of neuroinflammation, 17(1), 168-168 (2020-05-30)
Neuroinflammation is an important host defense response to secondary brain injury after intracerebral hemorrhage (ICH). Triggering receptor expressed on myeloid cells 2 (TREM2) confers strong neuroprotective effects by attenuating neuroinflammation in experimental ischemic stroke. Recent studies suggest that apolipoprotein E
Teng Jiang et al.
Neurobiology of aging, 36(12), 3176-3186 (2015-09-15)
Tau pathology is a pathological hallmark for several neurodegenerative diseases including Alzheimer's disease and frontotemporal dementia. As a novel susceptibility gene for these 2 diseases, triggering receptor expressed on myeloid cells 2 (TREM2) gene encodes an immune receptor that is
Rumana Akhter et al.
Molecular immunology, 131, 171-179 (2021-01-20)
Alzheimer's disease (AD) is characterized by the accumulation in the brain of extracellular amyloid β (Aβ) plaques as well as intraneuronal inclusions (neurofibrillary tangles) consisting of total tau and phosphorylated tau. Also present are dystrophic neurites, loss of synapses, neuronal

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique