Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU077831

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCACCCATTGTGATTGTGGAAGATAGAATTCAATTTGAACTCAGGTTGTTTATGAGGGGAAAAAAACAGTTGCATAGAGTATAGCTCTGTAGTGGAATATGTCTTCTGTATAACTAGGCTGTTAACCTATGATTGTAAAGTAGCTGTAAGAATTTCCCAGTGAAATAAAAAAAAATTTTAAGTGTTCTCGGGGATGCATAGATTCATCATTTTCTCCACCTTAAAAATGCGGGCATTTAAGTCTGTCCATTATCTATATAGTCCTGTCTTGTCTATTGTATATATAATCTATATGATTAAAGAAAATATGCATAATCAGACAAGCTTGAATATTGTTTTTGCACCAGACGAACAGTGAGGAAATTCGGAGCTATACATATGTGCAGAAGGTTACTACCTAGGGTTTATGCTTAATTTTAATTGGAGGAAATGAATGCTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seong-Lan Yu et al.
Molecular carcinogenesis, 55(12), 1915-1926 (2015-11-21)
MicroRNAs (miRNAs) are recognized as crucial posttranscriptional regulators of gene expression, and play critical roles as oncogenes or tumor suppressors in various cancers. Here, we show that miR-196b is upregulated in mesenchymal-like-state non-small cell lung cancer (NSCLC) cells and lung
Yilin Liu et al.
International journal of oncology, 54(5), 1809-1820 (2019-03-01)
Several microRNAs (miRNAs or miRs) that regulate a variety of cancer‑related events are dysregulated in osteosarcoma (OS). An exploration of the specific roles of miRNAs in OS is crucial for the identification of suitable therapeutic targets. Previous studies have shown that
Xiaoping Liu et al.
Placenta, 51, 38-48 (2017-03-16)
Functional placenta formation is crucially dependent on extravillous trophoblast migration and invasion. EPHB4 has been identified to play a negative but important role in regulating trophoblast biological function, whereas the upstream regulation mechanism remains unknown. As reported, there is a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique