Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU077121

Sigma-Aldrich

MISSION® esiRNA

targeting human OCLN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

James Keaney et al.
Science advances, 1(8), e1500472-e1500472 (2015-10-23)
The blood-brain barrier (BBB) is essential for maintaining brain homeostasis and protecting neural tissue from damaging blood-borne agents. The barrier is characterized by endothelial tight junctions that limit passive paracellular diffusion of polar solutes and macromolecules from blood to brain.
Kentaro Jingushi et al.
International journal of oncology, 51(1), 289-297 (2017-05-24)
Renal cell carcinoma (RCC) is the most common neoplasm of the adult kidney, and clear cell RCC (ccRCC) represents its most common histological subtype. Although several studies have reported high expression of miR-122 in ccRCC, its physiological role remains unclear.
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Thomas Volksdorf et al.
The American journal of pathology, 187(6), 1301-1312 (2017-04-17)
Tight junction (TJ) proteins are known to be involved in proliferation and differentiation. These processes are essential for normal skin wound healing. Here, we investigated the TJ proteins claudin-1 and occludin in ex vivo skin wound healing models and tissue samples
Dalia S Elhelw et al.
Archives of virology, 162(11), 3283-3291 (2017-06-24)
Occludin (OCLN) is an essential factor for HCV entry through interacting with other surface receptors. The aim of this study was to investigate the epigenetic regulation of Occludin expression and to study its impact on viral infectivity. microRNAs expression was

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique