Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU075381

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM17

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le30 mai 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le30 mai 2025

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG

Numéro d'accès Ensembl | humain

ENSG00000151694

Numéro d'accès NCBI

NM_003183

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ADAM17(6868) , ADAM17(6868)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
ACKS
HXT
MIT
LHT
TVS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
Qi Zhang et al.
Biochemical and biophysical research communications, 503(4), 2333-2339 (2018-07-03)
We investigated the role of a disintegrin and metalloproteinase 17 (ADAM17) in chemo resistance, and to clarify the mechanism underlying reverse of L-OHP resistance by knockdown of ADAM17. CRC tissues with corresponding adjacent normal tissues were collected. The mRNA and
Takaaki Uchibori et al.
Cytokine, 90, 88-95 (2016-11-20)
Osteopontin (OPN) is a pro-fibrotic molecule upregulated by pro-inflammatory cytokines. Interleukin (IL)-6 functions downstream of IL-1β and has unique signal pathways: classic- or trans-signaling via membrane-bound IL-6R or soluble IL-6R (sIL-6R). We investigated the effect of IL-6 trans-signaling on the
Wei Li et al.
International journal of molecular medicine, 43(2), 914-926 (2018-12-21)
Disintegrin and metalloproteinase domain-containing proteins (ADAMs) have been implicated in cell adhesion, signaling and migration. The aim of the present study was to identify key members of the ADAM protein family associated with the metastasis of gastric cancer and to
Jacob J Orme et al.
Oncoimmunology, 9(1), 1744980-1744980 (2020-05-05)
ADAM10 and ADAM17 expression and soluble PD-L1 (sPD-L1) predict poor prognosis in many malignancies, including in patients treated with PD-(L)1 inhibitors. The mechanism of soluble PD-L1 production and its effects are unknown. Here we uncover a novel mechanism of ADAM10-
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique