Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU075271

Sigma-Aldrich

MISSION® esiRNA

targeting human TNIP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCAGAAGATCACTGAGCTGCGTCAGAAGCTGGCTGATTTGCAGAAGCAGGTGACTGACCTGGAGGCCGAGCGGGAGCAGAAGCAGCGTGACTTTGACCGCAAGCTCCTCCTGGCCAAGTCCAAGATTGAAATGGAGGAGGCAAGTACCGACAAGGAGCAGCTGACAGCAGAGGCCAAGGAGCTGCGCCAAAAGGTCAAGTACCTGCAGGATCAGCTGAGCCCACTCACCCGACAGCGTGAGTACCAGGAAAAGGAGATCCAGCGGCTCAACAAGGCCCTGGAGGAAGCACTGAGCATCCAAACCCCGCCATCATCTCCACCAACAGCATTTGGGAGCCCAGAAGGAGCAGGGGCCCTCCTAAGGAAACAGGAGCTGGTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rambon Shamilov et al.
Mediators of inflammation, 2020, 5919150-5919150 (2020-05-08)
TNIP1 protein is a widely expressed, cytoplasmic inhibitor of inflammatory signaling initiated by membrane receptors such as TLRs which recognize pathogen-associated and damage-associated molecular patterns (PAMPs and DAMPs). Keratinocyte TNIP1 deficiency sensitizes cells to PAMPs and DAMPs promoting hyperresponsive expression
Ellen M Westerhout et al.
Nucleic acids research, 33(2), 796-804 (2005-02-03)
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed
Lilla Erdei et al.
Frontiers in immunology, 9, 2155-2155 (2018-10-16)
Human skin cells recognize the presence of the skin microbiome through pathogen recognition receptors. Epidermal keratinocytes are known to activate toll-like receptors (TLRs) 2 and 4 in response to the commensal Cutibacterium acnes (C. acnes, formerly known as Propionibacterium acnes)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique