Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU070981

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le24 mars 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le24 mars 2025

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT

Numéro d'accès Ensembl | humain

ENSG00000101412

Numéro d'accès NCBI

NM_005225

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... E2F1(1869) , E2F1(1869)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
WPU
LOU
XJU
BUT
HQS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qian Li et al.
Cell death & disease, 11(9), 757-757 (2020-09-17)
Despite the ubiquitous mechanical cues at both spatial and temporal dimensions, cell identities and functions are largely immune to the everchanging mechanical stimuli. To understand the molecular basis of this epigenetic stability, we interrogated compressive force-elicited transcriptomic changes in mesenchymal
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Jung-Jyh Hung et al.
Experimental hematology & oncology, 1(1), 18-18 (2012-12-06)
The transcription factor E2F1 has been implicated in cell cycle control and DNA damage response. Paradoxically, E2F1 can promote apoptosis and function as tumor suppressor. In non-small cell lung cancer (NSCLC), there are conflicting data for clinical significance of E2F1
Wen Luo et al.
Scientific reports, 6, 27904-27904 (2016-06-11)
miR-17 family microRNAs (miRNAs) are crucial for embryo development, however, their role in muscle development is still unclear. miR-20a-5p and miR-20b-5p belong to the miR-17 family and are transcribed from the miR-17~92 and miR-106a~363 clusters respectively. In this study, we
Lei Liu et al.
Oncology reports, 37(6), 3597-3605 (2017-05-13)
Tripartite motif containing 28 (TRIM28) is a universal corepressor for Kruppel‑associated box zinc finger proteins. In our previous study, it was shown that expression of TRIM28 is upregulated in non‑small cell lung cancer (NSCLC) cell lines and tissues. Here, we
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique