Accéder au contenu
Merck
Toutes les photos(2)

Principaux documents

EHU070511

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(2)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCTCCTTCCCA

Numéro d'accès Ensembl | humain

ENSG00000135446

Numéro d'accès NCBI

NM_000075

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDK4(1019) , CDK4(1019)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JUU
IYT
GWT
WNS
DZR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjing Shang et al.
EBioMedicine, 53, 102672-102672 (2020-03-03)
Abnormal expression of the orphan nuclear receptor Nurr1 is a critical factor in the etiology of multiple cancers. However, its potential role in gastric cancer (GC) remains elusive. In this study, we have demonstrated that the expression of Nurr1 was
Amriti R Lulla et al.
Cancer research, 77(24), 6902-6913 (2017-10-25)
CDK4/6 targeting is a promising therapeutic strategy under development for various tumor types. In this study, we used computational methods and The Cancer Genome Atlas dataset analysis to identify novel miRNAs that target CDK4/6 and exhibit potential for therapeutic development
Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Smruthi Vijayaraghavan et al.
Nature communications, 8, 15916-15916 (2017-06-28)
Deregulation of the cell cycle machinery is a hallmark of cancer. While CDK4/6 inhibitors are FDA approved (palbociclib) for treating advanced estrogen receptor-positive breast cancer, two major clinical challenges remain: (i) adverse events leading to therapy discontinuation and (ii) lack
Afficher tous les articles scientifiques apparentés

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique