Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU070071

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF12A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGACAATGTGCCCCCTGCCAGCCGGGGCTCGCCCACTCATCATTCATTCATCCATTCTAGAGCCAGTCTCTGCCTCCCAGACGCGGCGGGAGCCAAGCTCCTCCAACCACAAGGGGGGTGGGGGGCGGTGAATCACCTCTGAGGCCTGGGCCCAGGGTTCAGGGGAACCTTCCAAGGTGTCTGGTTGCCCTGCCTCTGGCTCCAGAACAGAAAGGGAGCCTCACGCTGGCTCACACAAAACAGCTGACACTGACTAAGGAACTGCAGCATTTGCACAGGGGAGGGGGGTGCCCTCCTTCCTAGAGGCCCTGGGGGCCAGGCTGACTTGGGGGGCAGACTTGACACTAGGCCC

Numéro d'accès Ensembl | humain

ENSG00000006327

Numéro d'accès NCBI

NM_016639

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TNFRSF12A(51330) , TNFRSF12A(51330)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuefeng Qi et al.
Frontiers in cellular and infection microbiology, 7, 315-315 (2017-07-27)
TLR4 in intestinal epithelial cells has been shown both inflammatory and homeostatic roles following binding of its cognate ligand lipopolysaccharide (LPS). TWEAK-Fn14 axis plays an important role in pathologies caused by excessive or abnormal inflammatory responses. This study aimed to
Li Hao et al.
Journal of cellular and molecular medicine, 22(9), 4344-4353 (2018-07-05)
Atrial myocyte hypertrophy is one of the most important substrates in the development of atrial fibrillation (AF). The TWEAK/Fn14 axis is a positive regulator of cardiac hypertrophy in cardiomyopathy. This study therefore investigated the effects of Fn14 on atrial hypertrophy
Zhengwei Li et al.
American journal of translational research, 8(12), 5386-5398 (2017-01-13)
Angiotesin II (Ang II) plays an important role in cardiac remodeling. Fibroblast growth factor inducible-14 (Fn14) is the smallest member of the tumor necrosis factor superfamily of receptors. Currently, little is known about the functional role of Fn14 in the
Xuefeng Qi et al.
The Journal of general virology, 99(1), 36-43 (2017-12-09)
The pathogenesis of H9N2 subtype avian influenza virus (AIV) infection in hens is often related to oviduct tissue damage. Our previous study suggested that H9N2 AIV induces cellular apoptosis by activating reactive oxygen species (ROS) accumulation and mitochondria-mediated apoptotic signalling
Alison Roos et al.
Molecular cancer research : MCR, 16(7), 1185-1195 (2018-05-05)
Glioblastoma multiforme (GBM) is the most common brain malignancies in adults. Most GBM patients succumb to the disease less than 1 year after diagnosis due to the highly invasive nature of the tumor, which prevents complete surgical resection and gives
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique