Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU069131

Sigma-Aldrich

MISSION® esiRNA

targeting human XBP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yukako Tokutake et al.
International journal of molecular sciences, 21(1) (2020-01-01)
In skeletal muscle, myoblast differentiation results in the formation of multinucleated myofibers. Although recent studies have shown that unfolded protein responses (UPRs) play an important role in intracellular remodeling and contribute to skeletal muscle differentiation, the involvement of IRE1-XBP1 signaling
A-F Song et al.
European review for medical and pharmacological sciences, 24(22), 11675-11682 (2020-12-05)
Rheumatoid arthritis (RA) is an autoimmune, inflammatory disease mainly manifested by joint damage. Its mechanism is not completely clear at present. Previous studies have found that microRNA-34a-5p (miR-34a-5p) is involved in the development of many inflammatory diseases. In this study
Joshua M Royal et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 13527-13545 (2019-09-29)
Cholera toxin B subunit (CTB) exhibits broad-spectrum biologic activity upon mucosal administration. Here, we found that a recombinant CTB containing an endoplasmic reticulum (ER) retention motif (CTB-KDEL) induces colon epithelial wound healing in colitis via the activation of an unfolded
Hui-Ting Hsu et al.
Clinica chimica acta; international journal of clinical chemistry, 479, 66-71 (2018-01-07)
Squamous cell carcinoma is the most common cancer of the oral cavity. In spite of advancements in surgical, chemoradiological and targeted therapies, these therapeutic strategies still have had little impact on survival rates. X-box binding protein-1 (XBP-1) is a potent
Akihiro Kishino et al.
Scientific reports, 7(1), 4442-4442 (2017-07-02)
The purpose of this study was to clarify the relationship among X-box-binding protein 1 unspliced, spliced (XBP1u, s), Forkhead box O1 (FoxO1) and autophagy in the auditory cells under endoplasmic reticulum (ER) stress. In addition, the relationship between ER stress

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique