Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU069001

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC27A4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCCGGCTATTGTGAAAGACCCGCTGTTCTATCTAGATGCCCAGAAGGGCCGCTACGTCCCGCTGGACCAAGAGGCCTACAGCCGCATCCAGGCAGGCGAGGAGAAGCTGTGATTCCCCCCATCCCTCTGAGGGCCGGCGGATGCTGGATCCGGAGCCCCAGGTTCCGCCCCAGAGCGGTCCTGGACAAGGCCAGACCAAAGCAAGCAGGGCCTGGCACCTCCATCCTGAGGTGCTGCCCCTCCATCCAAAACTGCCAAGTGACTCATTGCCTTCCCAACCCTTCCAGAGGCTTTCTGTGAAAGTCTCATGTCCAAGTTCCGTCTTCTGGGCTGGGCAGGCCCTCTGGTTCCCAGGCTGAGACTGACGGGTTTTCTCAGGATGATGTCTTGGGTGAGGGTAGGGAGAGGAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tim Benninghoff et al.
Diabetes, 69(11), 2281-2293 (2020-09-02)
The two closely related RabGTPase-activating proteins (RabGAPs) TBC1D1 and TBC1D4 play a crucial role in the regulation of GLUT4 translocation in response to insulin and contraction in skeletal muscle. In mice, deficiency in one or both RabGAPs leads to reduced
Wenjing Li et al.
Scientific reports, 7, 44659-44659 (2017-03-18)
Persistent elevation of plasma TNF-α is a marker of low grade systemic inflammation. Palmitic acid (PA) is the most abundant type of saturated fatty acid in human body. PA is bound with albumin in plasma and could not pass through

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique