Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU068551

Sigma-Aldrich

MISSION® esiRNA

targeting human YTHDF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le11 mai 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le11 mai 2025

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTTGAGTCCACAGGCAAGGCCCAATAATGCATATACTGCCATGTCAGATTCCTACTTACCCAGTTACTACAGTCCCTCCATTGGCTTCTCCTATTCTTTGGGTGAAGCTGCTTGGTCTACGGGGGGTGACACAGCCATGCCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCCCCACTTCCTACCAGATGCAATGTTTGGGCAACCAGGAGCCCTAGGTAGCACTCCATTTCTTGGTCAGCATGGTTTTAATTTCTTTCCCAGTGGGATTGACTTCTCAGCATGGGGAAATAACAGTTCTCAGGGACAGTCTACTCAGAGCTCTGGATATAGTAGCAATTATGCTTATGCACCTAGCTCCTTAGGTGGAGCCATGATTGATGGACAGTCAGCTTTTGCCAATGA

Numéro d'accès Ensembl | humain

ENSG00000198492

Numéro d'accès NCBI

NM_016258

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... YTHDF2(51441) , YTHDF2(51441)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chuanzhao Zhang et al.
Oncogene, 39(23), 4507-4518 (2020-05-06)
N6-methyladenosine (m6A) RNA methylation contributes to the cancer stem cell (CSC) phenotype through regulating gene expression. YTHDF2, an m6A reader, was shown to be associated with hepatocellular carcinoma (HCC) patient prognosis. However, the effect of YTHDF2 on liver CSC and
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Sara Zaccara et al.
Cell, 181(7), 1582-1595 (2020-06-04)
N6-methyladenosine (m6A) is the most abundant mRNA nucleotide modification and regulates critical aspects of cellular physiology and differentiation. m6A is thought to mediate its effects through a complex network of interactions between different m6A sites and three functionally distinct cytoplasmic
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique